Портал функционирует при финансовой поддержке Федерального агентства по печати и массовым коммуникациям.

Страницы: Пред. 1 ... 9 10 11 12 13 ... 16 След.
RSS
СПИД - самая чудовищная мистификация 20 века!
Цитата
Учёный пишет:
вирус никогда не был выделен согласно стандартной процедуре принятой для идентификации вирусов
И вот так сразу бросать такую информацию в инет :D Много дров наломать можно ;)
Цитата
Учёный пишет:
Просто я умею читать и понимать прочитанное.
Это Вас кто-то обманул.
Набейте ему морду.
Не судите опрометчиво.

Цитата
Homo Ludens пишет:
Собственный вывод Гордона в конце передачи - вируса иммунодефицита человека просто нет, его придумали.
Иначе как треплом назвать его не возникает желания. Обычный желтый журноламер, падкий на сенсации. Причем который очень любит себя, при этом не давая высказаться другим людям. Впрочем, может быть у него просто работа такая, а сам по себе он белый и пушистый - не знаю. Но его поведение в любом случае мне глубоко неприятно.
Изменено: BETEP IIEPEMEH - 06.05.2010 00:32:35
Цитата
В.Архангельская пишет:
Колос, если я и госпожа, то только сама себе, можете не уничижаться так в будущем. Ваши эмоции, улыбки меня абсолютно не интересуют, даже если и вызваны моими словами.

P.S. 2 недели назад по первому каналу в пятницу прошла передача с Александром Гордоном, тема которой была практически та же - ВИЧ это миф. Собственный вывод

Ладно, не хотите быть "госпожёй" - очень рад, самого коробит от этого словечка, мне ктати тоже совершенно пофигу на то что вам там "пофигу", гражданка Архангельская, :D  
Ели вы заметили, речь в теме не о вас и не о ваших там "нравится ненравится, интересно или пофик"
Может всётаки перейдем на нормальный, не сапиеновский стиль общения? Прошу заметить это вы сходу ворвались со своим Гордоном и Митрофаном как слон в попугайскую клетку.
Так всётаки как я и говорил мне также плевать как на Гордона так и на других, сказал же - не смотрю телевизор.
Выходит единственныи кто "насмотрелся" это вы сами!  :D
Изменено: Колос - 06.05.2010 12:47:38
Бестолковое количество не переходит в качество!

 Колос
Цитата
BETEP IIEPEMEH пишет:
Цитата
Колос пишет:
Ничего там в природе не работает
Работает. Только внутри Вас общий вес всех симбиотических бактерий составляет порядка пары килограмм. Это и есть те самые миллиарды, о которых идет речь.
Пара килограм это ничто в сравнении с требуемым, и тем более эта пара вообще не принадлежит вирусу в его полном распоряжении, если он и может чтото "урвать" от хозяина на стартовом то это лишь лучшем случае несколько нанограм. Для полноценого "мутационного творчества" это ничто. А скажите какой средний ответ имунной системы, в который этот вирус должен успеть уложится провернуть все все свои биллиардные комбинации на заныканных нуклекислотных нанограммах?

Пусть даже этот пройдоха вообще умудрится заполучить все человеческие килограммы нукеотидного материала, это всё равно ничтожно мало. Тогда почему человек даже на последней стадии "инфекции" остаётся человеком а на расползается как амёба? Ведь у него не должно остаться никакого человеческого генокода, а всё что у него будет это мусор из неудачных вариаций вирусных штаммов.
Изменено: Колос - 06.05.2010 13:22:20
Бестолковое количество не переходит в качество!

 Колос
Ещё вопрос!
Даже миллионы мутаций, а это очень и очень мало для продуктивного селекционного отбора,  вообще для живой материи неприемлемая величина. Так что такое этот вирус там внутри организма "курит" что его так не по детски вставляет, где он  берёт такой атский мутаген?
Ладно с наркоманами можете выкрутится,  :D они мол сами ему и поставляют, но ка быть с другими категориями населения которые не только травку, но и сирареты и рюмки в руках не держали, а по теории они так же болеют и умирают.
?
Бестолковое количество не переходит в качество!

 Колос
Колос, заранее прошу извинить за слова, которые Вам покажутся обидными, но Вы написали бессмысленный пост.
Для того, чтобы рассуждать о предмете, тем более - выносить критические суждения, надо сначала этот предмет изучить.
Возьмите учебник по общей биологии для начала.
Не судите опрометчиво.

Цитата
Sapiens пишет:
Колос , заранее прошу извинить за слова, которые Вам покажутся обидными, но Вы написали бессмысленный пост.
Для того, чтобы рассуждать о предмете, тем более - выносить критические суждения, надо сначала этот предмет изучить.
Возьмите учебник по общей биологии для начала.

В учебнике кроме общих предположений ничего конкретного, он даже не указывает сколько теоретически обоснованных тонн генетаческого исходгонго материала нужно чтобы описанный "механизм" мог рреально существовать. Теория вероятностей ожидаемого результата вообще не научная чепуха, это обычный математический лохотрон.

В природе "случайность" никогда ничего не рождает и не производит.
Случайность вообще творчески идеально нейтральная субстанция.

Скажите, когда следует ожидать при равномерно заполненой воздухом комнате, что газ соберётся в одном углу, оставив остальное пространство в состоянии вакума?
Или хотя бы ожидать что на краткий миг образуется вакуум в каком нибудь углу?
Можете не заморачиваться - ответ НИКОГДА!

Так что вся теория "случайного изменения" и селективного отбора этих измененийвсё это дремучий лохотрон для идиотов.
Мироздание устроено совсем по другому.
Скажите, что за идиот там сидит внутри вируса и слепо перебирает все бесконечные варианты, вместо того чтобы просто взять и придумать уже готовый?
Даже для того чтобы перебирать и отсеивать нужно иметь гдето эталон-образец для этой операции.
Изменено: Колос - 06.05.2010 13:03:03
Бестолковое количество не переходит в качество!

 Колос
На форуме первого канала в связи с передачей ВИЧ/СПИД разгорелась дискуссия по поводу передачи Гордона.
Появились следующие заявления:

ArtificalIntelligent

Цитата

Решил проверить данное утверждение на вшивость. Благо это моя прямая специальность - поиск генов в геноме человека.

Итак, берем последовательность gag ВИЧ-1 человека, выделенный в России (это не важно откуда, т.к. разница не большая).

Вот эта последовательности. Тут так же указаны все индификаторы, чтобы любой мог проверить, что это та самая последовательность, что я не написал ее из головы.

>gi|294992893|gb|GU991883.1| HIV-1 isolate Pat22 from Russia gag protein (gag) gene, complete cds; and pol protein (pol) gene, partial cds
ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGCCAAATGGGAGAAAATTCGG­TTGNGGCCAG
GAGGAAGAAACCAATATAAAATGAAACATTTAGTATGGGCAAGCAGGGAGATGGAGAGAT­TTGCACTTAA
CCCTGGCCTTATGGAAACAGCAGAAGGTTGTCAACAAATAATGGTACAGATACAACCAGC­TCTCAAGACA
GGAACAGAGGAGCTTAGATCATTATATAATACAATAGCAGTTCTCTATTGTGTACACCAA­AGGATAGAGA
TAAAAGACACCAAAGAAGCTCTAGAGGAAATAGAAAAGCTACAAAAGAAAAGTCAGCAAA­AAACACAGCA
GGCAGCAACAGATACAGGAAACAGTAGCCAAGTCAGCCAAAATTATCCTATAGTGCAGAA­TGCACAAGGG
CAAATGGTACACCAGGCCATATCACCTAGGACCTTGAATGCATGGGTAAAAGTAGTAGAA­GAAAAGTCCT
TTAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAGGATT­TGAATACCAT
GCTAAACACAGTGGGGGGGCATCAAGCAGCTATGCAGATGCTAAAGGAGGCTATCAATGA­TGAAGCTGCA
GAGTGGGACAGGTTACACCCACCACAGGCAGGGCCTATTGCGCCAGGCCAGATAAGAGAA­CCAAGGGGAA
GTGATATAGCAGGAGCTACTAGTACCCTGCAGGAGCAAATAACATGGATGACCAGCAACC­CACCTATCCC
AGTGGGAGAAATTTATAAAAGATGGATAATCTTGGGATTAAATAGAATAGTAAGAATGTA­TAGCCCTGTC
AGCATTTTAGACATAAGACAAGGGCCAAAAGAACCCTTTAGAGATTATGTAGATAGGTTC­TTTAAAACTT
TAAGAGCTGAGCAAGCTACACAGGAAGTAAAAAGCTGGATGACAGACACCTTGTTGRTCC­AAAATGCGAA
CCCAGATTGTAAGAACATCTTAAGAGCATTAGGACCAGGAGCTTCACTAGAAGAAATGAT­GACAGCATGT
CAGGGAGTGGGAGGACCCAGCCATAAAGCAAGAGTTTTAGCTGAAGCAATGAGCCAGGCA­TCAGGTGCCG
CAGCGGCCATAATGATGCAGAAAAGCAATTTTAAGGGCCCAAGAAGAGCTATTAAGTGTT­TCAACTGTGG
CAAGGATGGACATATAGCCAGAAATTGCAGGGCCCCTAGAAAGAAGGGCTGTTGGAAATG­TGGAAAGGAG
GGACATCAAATGAAAGATTGCACRGAGAGCAAGGCTCATTTTTTAGGGAAAATCTGGCCC­TCCAGCAGGG
AGAGGCCAGGGAATTTTCTTCAGAACAGGACAGAGCCAACAGCCCCACCAGCAGAGAGCT­TCGGGGAGGA
GATAGCCCCTGCCCCGAAACAGGAGCCGAAGAAGGAGGAGCTATATCCCTTAGCCTCCCT­CAAATCACTC
TTTGGCAGCGACCCYTAGTCTCAGTAAGAGTRGGGGGACAGCTAATAGAAGCYCTATTAG­ACACAGGAGC
AGATGATACAGTATTAGAAGACATAAATTTACCAGGAAAATGGAARCCAAAAATGATAGG­GGGAATTGGA
GGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAAATTTGTGGAAAAAAGGCT­ATAGGGACAG
TATTAGTAGGACCTACACCTATCAACATAATTGGGAGAAATATGTTGACTCAGATTGGYT­GTACTTTAAA
TTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAMATTAAAGCCAGGAATGGATGGGCC­AAAGATCAAA
CAATGGCCATTGACAGAAGAGAAAATAAAAGCATTAATAGAAATTTGTACAGAAATGGAA­AAGGAAGGAA
AAATTTCAAAAATTGGGCCTGAAAATCCATACAACACTCCAATATTTGCTATAAAGAAAA­AAGACAGTAC
TAAATGGAGAAAATTAGTAGATTTCAGAGAGCTCAATAAAAGAACTCAAGACTTCTGGGA­GGTACAATTA
GGAATACCTCACCCAGCAGGGTTAAAACAGAAAAAATCAGTAACAGTACTAGATGTGGGG­GATGCATATT
TTTCAGTTCCATTAGATGAAAGCTTTAGAAAGTATACTGCATTCACTATACCTAGTATAA­ATAATGARAC
ACCAGGAATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAAT­ATTCCAAAGT
AGCATGACAAAAATCTTAGAGCCCTTTAGAAARAGAAAYCCAGAAATGGTGATCTACCAA­TACATGGATG
ATTTATATGTGGGATCTGACTTAGAATTAGGACAACATAGAGCAAAAATAGAAGAGTTAA­GAGAGCATTT
ACTGARATGGGGATTTACCACACCAGATAARAARCATCAGAAAGAACCTCCATTCTTRTG­GATGGGATAT
GAGCTCCATCCTGACAARTGGACGGTACAACCTATACAGTTGCCAGATAAAGARAGCTGG­ACTGTCAATG
ATATACAAAAGCTAGTGGGAAAACTAAATTGGGCAAGTCAGATTTATCCAGGAATTAGAA­TAAGGCAACT
ATGTAAACTCATTAGGGGGGCTAAAGCACTAACAGACATAGTACCACTAACARAAGAAGC­AGAGCTAGCA
CTA

Итак, кидаем эту последовательность в программ BLast против генома человека. Программа Blast ищет похожие последовательности. Это стандартная программ для поиска гомологичных (т.е. похожих) генетических последовательностей.

Вывожу результат работы программы:

Description
human build 37 genome database (reference GRCh37 and alternate assemblies) Program
BLASTN 2.2.23+

No significant similarity found.

Это означает, что в геноме человека, ни в одной известной сборке, такого гена нет. Даже близко нет, потому что даже если бы он был хоть чуть-чуть родственным, он бы нашелся. Более того, этого гена нет ни в одном известном геноме млекопитающего. Я это тоже проверил. Зато против вирусных последовательностей находится прекрасно. Кстати, этот фрагмент взят из генома вируса ВЫДЕЛЕННОГО в России ВИЧ-1. Вот работа

Knops,E., Daeumer,M., Awerkiew,S., Kartashev,V., Schuelter,E., Kutsev,S., Brakier-Gingras,L., Kaiser,R., Pfister,H. and Verheyen,J.
Evolution of PI resistance in the gag and pol gene of HIV subtype G isolates (работы сделана в Institute of Virology, University of
Cologne )

Это воспроизводимая процедура, которую может проделать любой и убедиться, что товарищи Вам наглым образом соврали. Последовательности gag вируса иммунодефицита человека в геноме человека не обнаружено.

Где его можно обнаружить, так это в ДНК лимфоцита ВИЧ инфицированного. Ну может еще в паре типов клеток, у которых эксперссированы нужные рецепторы цитокинов и CD4. Все-таки это ретровирус и он может по определению выстроиться в геном, чтобы размножаться.

Если речь идет о других вирусных изолятах, то данный изолят российского вируса похож больше всего на изолят вируса из кубы
HIV-1 isolate Cu87 from Cuba, complete genome.

Это вирус был изолирован в 2007 в ходе следующей работы:
J Acquir Immune Defic Syndr. 2007 Jun 1;45(2):151-60.
Identification of 3 phylogenetically related HIV-1 BG intersubtype circulating recombinant forms in Cuba.
Sierra M, Thomson MM, Posada D, Pérez L, Aragonés C, González Z, Pérez J, Casado G, Nájera R.

Желающие могут использовать Blast указанной последовательности и ознакомиться с несколькими тысячами прочитанных генов других изолированных вирусов ВИЧ, посмотреть, чем они отличаются и так далее.

Если мы можем отличить ВИЧ кубинский от ВИЧ русского, неужели кто-то думает, что мы не отличим ВИЧ от гена человека?

ArtificalIntelligent
Цитата
Цитата
Секвенирование для нас - дом родной, было бы что секвенировать. Вы же нам так и не объяснили, какого лешего некая фракция в градиенте плотности по умолчанию содержит только вирус и ничего кроме вируса? Хотя даже малым детям известно, что любая нуклеиновая кислота, включая хозяйскую, легко рвется на куски при механическим воздействии и может запросто попасть в ту же самую фракцию.

Нет, ну Вы точно не понимаете вообще о чем говорите. Какая фракция? Какой градиент плотности? Вы же не знаете как секвенируют. Сначала выделяют всю РНК. Там будет РНК вируса и РНК человека и РНК кишечной палочки, которая заползла в человека и так далее. Эту РНК превращают в ДНК. Затем с помощью ПЦР амплицифируют (размножают) последовательность, края которой нам известны - ту, которую мы хотим точно прочитать большим фрагментом. В результате у нас из нескольких молекулы образуется много миллиардов копий. И их отделяют на элетрофорезном геле. Затем эту последовательность встраивают в бактериальную плазмиду, защищающую бактерию от антибиоитика, при условии успешной вставки. Затем плазмиду встраивают в бактерий, делают это так, чтоб в каждую бактерию встроилось не более одной плазмиды. Бактерии с такой плазмидой вырастают и образуют колонию - клон (без плазмиды - дохут). Далее, использую специфические праймеры, которые соответствуют исключительно последовательности данной плазмиды и читают целиком последовательность вставки. А затем, сравнивают программой Blast все эту последовательность с вирусом.

Если последовательность совпала, значит в образце присутствовал самый настоящий вирус. Мы это знаем на 100%.

Вот если Вы возьмете образец крови человека и секвенатор, после упомянутой процедуры выдаст такое:

ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGCCAAATGGGAGAAAATTCGG­TTGNGGCCAG
GAGGAAGAAACCAATATAAAATGAAACATTTAGTATGGGCAAGCAGGGAGATGGAGAGAT­TTGCACTTAA
CCCTGGCCTTATGGAAACAGCAGAAGGTTGTCAACAAATAATGGTACAGATACAACCAGC­TCTCAAGACA
GGAACAGAGGAGCTTAGATCATTATATAATACAATAGCAGTTCTCTATTGTGTACACCAA­AGGATAGAGA
TAAAAGACACCAAAGAAGCTCTAGAGGAAATAGAAAAGCTACAAAAGAAAAGTCAGCAAA­AAACACAGCA
GGCAGCAACAGATACAGGAAACAGTAGCCAAGTCAGCCAAAATTATCCTATAGTGCAGAA­TGCACAAGGG
CAAATGGTACACCAGGCCATATCACCTAGGACCTTGAATGCATGGGTAAAAGTAGTAGAA­GAAAAGTCCT
TTAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAGGATT­TGAATACCAT
GCTAAACACAGTGGGGGGGCATCAAGCAGCTATGCAGATGCTAAAGGAGGCTATCAATGA­TGAAGCTGCA
GAGTGGGACAGGTTACACCCACCACAGGCAGGGCCTATTGCGCCAGGCCAGATAAGAGAA­CCAAGGGGAA
GTGATATAGCAGGAGCTACTAGTACCCTGCAGGAGCAAATAACATGGATGACCAGCAACC­CACCTATCCC
AGTGGGAGAAATTTATAAAAGATGGATAATCTTGGGATTAAATAGAATAGTAAGAATGTA­TAGCCCTGTC
AGCATTTTAGACATAAGACAAGGGCCAAAAGAACCCTTTAGAGATTATGTAGATAGGTTC­TTTAAAACTT
TAAGAGCTGAGCAAGCTACACAGGAAGTAAAAAGCTGGATGACAGACACCTTGTTGRTCC­AAAATGCGAA
CCCAGATTGTAAGAACATCTTAAGAGCATTAGGACCAGGAGCTTCACTAGAAGAAATGAT­GACAGCATGT
CAGGGAGTGGGAGGACCCAGCCATAAAGCAAGAGTTTTAGCTGAAGCAATGAGCCAGGCA­TCAGGTGCCG
CAGCGGCCATAATGATGCAGAAAAGCAATTTTAAGGGCCCAAGAAGAGCTATTAAGTGTT­TCAACTGTGG
CAAGGATGGACATATAGCCAGAAATTGCAGGGCCCCTAGAAAGAAGGGCTGTTGGAAATG­TGGAAAGGAG
GGACATCAAATGAAAGATTGCACRGAGAGCAAGGCTCATTTTTTAGGGAAAATCTGGCCC­TCCAGCAGGG
AGAGGCCAGGGAATTTTCTTCAGAACAGGACAGAGCCAACAGCCCCACCAGCAGAGAGCT­TCGGGGAGGA
GATAGCCCCTGCCCCGAAACAGGAGCCGAAGAAGGAGGAGCTATATCCCTTAGCCTCCCT­CAAATCACTC
TTTGGCAGCGACCCYTAGTCTCAGTAAGAGTRGGGGGACAGCTAATAGAAGCYCTATTAG­ACACAGGAGC
AGATGATACAGTATTAGAAGACATAAATTTACCAGGAAAATGGAARCCAAAAATGATAGG­GGGAATTGGA
GGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAAATTTGTGGAAAAAAGGCT­ATAGGGACAG
TATTAGTAGGACCTACACCTATCAACATAATTGGGAGAAATATGTTGACTCAGATTGGYT­GTACTTTAAA
TTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAMATTAAAGCCAGGAATGGATGGGCC­AAAGATCAAA
CAATGGCCATTGACAGAAGAGAAAATAAAAGCATTAATAGAAATTTGTACAGAAATGGAA­AAGGAAGGAA
AAATTTCAAAAATTGGGCCTGAAAATCCATACAACACTCCAATATTTGCTATAAAGAAAA­AAGACAGTAC
TAAATGGAGAAAATTAGTAGATTTCAGAGAGCTCAATAAAAGAACTCAAGACTTCTGGGA­GGTACAATTA
GGAATACCTCACCCAGCAGGGTTAAAACAGAAAAAATCAGTAACAGTACTAGATGTGGGG­GATGCATATT
TTTCAGTTCCATTAGATGAAAGCTTTAGAAAGTATACTGCATTCACTATACCTAGTATAA­ATAATGARAC
ACCAGGAATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAAT­ATTCCAAAGT
AGCATGACAAAAATCTTAGAGCCCTTTAGAAARAGAAAYCCAGAAATGGTGATCTACCAA­TACATGGATG
ATTTATATGTGGGATCTGACTTAGAATTAGGACAACATAGAGCAAAAATAGAAGAGTTAA­GAGAGCATTT
ACTGARATGGGGATTTACCACACCAGATAARAARCATCAGAAAGAACCTCCATTCTTRTG­GATGGGATAT
GAGCTCCATCCTGACAARTGGACGGTACAACCTATACAGTTGCCAGATAAAGARAGCTGG­ACTGTCAATG
ATATACAAAAGCTAGTGGGAAAACTAAATTGGGCAAGTCAGATTTATCCAGGAATTAGAA­TAAGGCAACT
ATGTAAACTCATTAGGGGGGCTAAAGCACTAACAGACATAGTACCACTAACARAAGAAGC­AGAGCTAGCA
CTA

то мы знаем, не только, что это ВИЧ, но так же, что это ВИЧ-1, что он похож на изолят из России, и можем смело ставить ВИЧ+ диагноз.
на что последовал ответ:

tgg
Цитата
Цитата
Цитата
Решил проверить данное утверждение на вшивость. Благо это моя прямая специальность - поиск генов в геноме человека.

Итак, берем последовательность gag ВИЧ-1 человека

Итак, кидаем эту последовательность в программ BLast против генома человека
Спрашивается, зачем кидать РНК в программу поиска ДНК???? Смысл????

Цитата
PS: глянула на секвенс, выложенную Art.Intel. в качестве вирусной РНК. Вот ее начало:

ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAA

Где тут урацил, я вас спрашиваю? Вы что там секвенировали-та???? Разве вы не знаете, что при транскрипции происходит сплайсинг (т.е. вырезание кусков транскриптов) продукта???? В итоге цепочка готовой РНК не является зеркальным отображением ДНК.

Интересный вы народ, товарищи ортодоксы. Сначала берете РНК, о происхождении которой наверняка известно только то, что она болтается в определенной фракции после центрифугирования в градиенте плотности. Потом проводите над этой безродной РНК дополнительные манипуляции, исходя из чисто механистических представлений о взаимосвязи между ДНК и РНК, и представляете нам результат своих экспериментов, лишенных какого-либо биологического смысла, как некое доказательство. Самим-то не смешно?
Цитата

Ну, а теперь дискотека! Как говорится, especially for you, господа ортодоксы.

Эх, жаль ArtInt. в разъездах. Надеюсь, что мой пост не ускользнет от его внимания.

Текст из патента на выявление РНК ВИЧ с помощью ПЦР:
www.patentstorm.us/patents/6531588/description.html

Novel PCR primers were developed and used to amplify the 0.7 kb, 1.57 kb, or 2.1 kb regions of HIV pol. The unique PCR primers hybridize to highly conserved regions of pol. According to certain embodiments, the PCR application employs a hot start enzyme, such as AmpliTaq Gold. The novel HIV pol amplification primers are:

0.7 kb primers-GGACTGTCAATGACATACAGMGTTAGTGG (SEQ ID NO:3), and

GGTTAAAATCACTAGCCATTGCTCTCC (SEQ ID NO:4);

1.57 kb primers-GGAAAAGGGCTGTTGGAAATGTG (SEQ ID NO:1), and

GGCTCTTGATAAATTTGATATGTCCATTG (SEQ ID NO:2),

2.1 kb primers-CTCATGTTCATCTTGGGCCTTATCTATTC (SEQ ID NO:13), and either

GCCAGGGAATTTTCTTCAGAGCAG (SEQ ID NO:12), or

GGCCAGGGMTTTTCTTCAGAGC (SEQ ID NO:14).

Итак, утверждается, что эти праймеры высокоспецифичны для ВИЧ.
Теперь заходим в программу Blast, разрекламированную Art.Intel., онлайн
blast.ncbi.nlm.nih.gov/Blast.цги
Выбираем nucleotide blast, затем human genomic и highly similar sequences и по совету того же автора закидываем туда последовательности праймеров.

Вот что у меня получилось для первых трех:
GGACTGTCAATGACATACAGMGTTAGTGG - 792 Blast Hits
GGTTAAAATCACTAGCCATTGCTCTCC - 2180 Blast Hits


GGAAAAGGGCTGTTGGAAATGTG - 1525 Blast Hits.

Вот вам и уникальные праймеры. biggrin.gif biggrin.gif biggrin.gif

Цитата
Оставшиеся четыре

GGCTCTTGATAAATTTGATATGTCCATTG (SEQ ID NO:2),
4511 Blast Hits

2.1 kb primers-CTCATGTTCATCTTGGGCCTTATCTATTC (SEQ ID NO:13),
1650 Blast Hits

GCCAGGGAATTTTCTTCAGAGCAG (SEQ ID NO:12)
3724 Blast Hits

GGCCAGGGMTTTTCTTCAGAGC (SEQ ID NO:14).
3254 Blast Hits

Ну, давайте, выкручивайтесь уже как-нибудь... laugh.gif laugh.gif laugh.gif


Из вашей же ссылки, об электронной микроскопии:

The ‘‘positive’’ contrast observed in thin section EM is mainly due to the heavy metals bound to the specimen and their scattering power, i.e., the distribution of heavy elements is shown rather than the details of the object itself (Figs.1, 5).

Thin section EM involves chemical fixation and complete dehydration of the specimen which definitely abolish any ‘‘natural’’ state of biological structures.

smile.gif

К сожалению, похоже, ArtificalIntelligent выбыл из обсуждения может ли кто-нибудь прокомментировать этот момент или заменить выбывшего?
http://forum.1tv.ru/index.php?showforum=149
Изменено: Warlock - 06.05.2010 13:05:00
Цитата
Колос пишет:
В природе "случайность" никогда ничего не рождает и не производит.
Случайность вообще творчески идеально нейтральная субстанция.
Прежде всего, слово "субстанция" тут вообще не к месту.
"Творчески нейтрально" вообще всё на свете, кроме человека.

Цитата
Колос пишет:
Так что вся теория "случайного изменения" всё это дремучий лохотрон для идиотов.
Это надо понимать, что Вы отрицаете случайность как таковую, и соответственно - математическую теорию вероятностей как способ познания случайных процессов?
Я правильно Вас понял?
Не судите опрометчиво.

Страницы: Пред. 1 ... 9 10 11 12 13 ... 16 След.
Читают тему (гостей: 4, пользователей: 0, из них скрытых: 0)

СПИД - самая чудовищная мистификация 20 века!